Skip site navigation (1)Skip section navigation (2)

FreeBSD Manual Pages

  
 
  

home | help
VCFWAVE(1)		 vcfwave (VCF transformation)		    VCFWAVE(1)

NAME
       vcfwave - reduces complex alleles by pairwise alignment with BiWFA

SYNOPSIS
       vcfwave

DESCRIPTION
       vcfwave	reduces	 complex alleles into simpler primitive	representation
       using pairwise alignment	with BiWFA.

       Often variant callers are not perfect.  vcfwave with its	companion tool
       vcfcreatemulti can take an existing VCF	file  that  contains  multiple
       complex	overlapping  and  even nested alleles and, like	Humpty Dumpty,
       can take	them apart and put them	together again in a more sane VCF out-
       put.  Thereby getting rid of false positives and	often greatly  simpli-
       fying the output.  We created these tools for the output	from long-read
       pangenome genotypers - with 10K base pair realignments -	and is used in
       the Human Pangenome Reference Consortium	analyses (HPRC).

       vcfwave	realigns reference and alternate alleles with the recently in-
       troduced	super fast bi-wavefront	aligner	(WFA).	vcfwave	parses out the
       original	`primitive' alleles into multiple VCF records  and  vcfcreate-
       multi  puts  them  together  again.  These tools	can handle insertions,
       deletions, inversions and nested	sequences.  In both tools  information
       is  tracked  on	original  positions  and  genotypes  are handled.  New
       records have IDs	that reference the source record ID.  Deletion alleles
       will result in  haploid	(missing  allele)  genotypes  overlapping  the
       deleted region.

       A typical workflow will call vcfwave to realign all ALT alleles against
       the  reference  and  spit  out simplified VCF records.  Next use	a tool
       such as bcftools	norm -m- to normalise the VCF records  and  split  out
       multiple	ALT alleles into separate VCF records.	Finally	use vcfcreate-
       multi to	create multi-allele VCF	records	again.

       PERFORMANCE:

       Unlike  traditional  aligners  that run in quadratic time, the recently
       introduced wavefront aligner WFA	runs in	time  O(ns+s^2),  proportional
       to the sequence length n	and the	alignment score	s, using O(s^2)	memory
       (or  O(s) using the ultralow/BiWFA mode).  Therefore WFA	does not choke
       on longer alignments.

       Speed-wise vcfwave can still be faster.	See also the performance  docs
       for some	metrics	and discussion.

       READING:

       See also	the humpty dumpty companion tool vcfcreatemulti.

   Options
       -h, -help
	      shows help message and exits.

       See more	below.

EXIT VALUES
       0      Success

       not 0  Failure

EXAMPLES
       Current command line options:

	      >>> head("vcfwave	-h",26)
	      >
	      usage: vcfwave [options] [file]
	      >
	      Realign reference	and alternate alleles with WFA,	parsing	out the
	      'primitive' alleles into multiple	VCF records. New records have IDs that
	      reference	the source record ID.  Genotypes/samples are handled
	      correctly. Deletions generate haploid/missing genotypes at overlapping
	      sites.
	      >
	      options:
		  -p, --wf-params PARAMS  use the given	BiWFA params (default: 0,19,39,3,81,1)
					  format=match,mismatch,gap1-open,gap1-ext,gap2-open,gap2-ext
		  -f, --tag-parsed FLAG	  Annotate decomposed records with the source record position
					  (default: ORIGIN).
		  -L, --max-length LEN	  Do not manipulate records in which either the	ALT or
					  REF is longer	than LEN (default: unlimited).
		  -K, --inv-kmer K	  Length of k-mer to use for inversion detection sketching (default: 17).
		  -I, --inv-min	LEN	  Minimum allele length	to consider for	inverted alignment (default: 64).
		  -t, --threads	N	  Use this many	threads	for variant decomposition (default is 1).
					  For most datasets threading may actually slow	vcfwave	down.
		  --quiet		  Do not display progress bar.
		  -d, --debug		  Debug	mode.
	      >
	      Note the -k,--keep-info switch is	no longer in use and ignored.
	      >
	      Type: transformation

       vcfwave	picks  complex	regions	and simplifies nested alignments.  For
       example:

	      >>> sh("grep 10158243 ../samples/10158243.vcf")
	      grch38#chr4     10158243	      >3655>3662      ACCCCCACCCCCACC ACC,AC,ACCCCCACCCCCAC,ACCCCCACC,ACA     60      .	      AC=64,3,2,3,1;AF=0.719101,0.0337079,0.0224719,0.0337079,0.011236;AN=89;AT=>3655>3656>3657>3658>3659>3660>3662,>3655>3656>3660>3662,>3655>3660>3662,>3655>3656>3657>3658>3660>3662,>3655>3656>3657>3660>3662,>3655>3656>3661>3662;NS=45;LV=0     GT      0|0     1|1     1|1     1|0     5|1     0|4     0|1     0|1     1|1     1|1     1|1     1|1     1|1     1|1     1|1     4|3     1|1     1|1     1|1     1|0     1|0     1|0     1|0     1|1     1|1     1|4     1|1     1|1     3|0     1|0     1|1     0|1     1|1     1|1     2|1     1|2     1|1     1|1     0|1     1|1     1|1     1|0     1|2     1|1     0

       This aligns and adjusts the genotypes accordingly splitting into	multi-
       ple records, one	for each unique	allele found in	the alignments:

	      >>> sh("../build/vcfwave -L 1000 ../samples/10158243.vcf|grep -v ^\#")
	      grch38#chr4     10158244	      >3655>3662_1    CCCCCACCCCCAC   C	      60      .	      AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;TYPE=del	GT	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0
	      grch38#chr4     10158244	      >3655>3662_2    CCCCCACCCCCACC  C	      60      .	      AC=3;AF=0.033708;AN=89;AT=>3655>3656>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=13;TYPE=del	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0
	      grch38#chr4     10158245	      >3655>3662_3    CCCCACCCCCACC   C	      60      .	      AC=64;AF=0.719101;AN=89;AT=>3655>3656>3657>3658>3659>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;TYPE=del	GT	0|0	1|1	1|1	1|0	0|1	0|0	0|1	0|1	1|1	1|1	1|1	1|1	1|1	1|1	1|1	0|0	1|1	1|1	1|1	1|0	1|0	1|0	1|0	1|1	1|1	1|0	1|1	1|1	0|0	1|0	1|1	0|1	1|1	1|1	0|1	1|0	1|1	1|1	0|1	1|1	1|1	1|0	1|0	1|1	0
	      grch38#chr4     10158251	      >3655>3662_4    CCCCACC C	      60      .	      AC=3;AF=0.033708;AN=89;AT=>3655>3656>3657>3658>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=6;TYPE=del	GT	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0
	      grch38#chr4     10158256	      >3655>3662_5    CC      C	      60      .	      AC=2;AF=0.022472;AN=89;AT=>3655>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;TYPE=del	GT	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|1	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	1|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0|0	0
	      grch38#chr4     10158257	      >3655>3662_6    C	      A	      60      .	      AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;TYPE=snp	GT	0|0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0

./vcfwave -L 10000 ../samples/grch38#chr8_36353854-36453166.vcf	>  ../test/da-
       ta/regression/vcfwave_4.vcf
			    run_stdout("vcfwave	     -L	     10000     ../sam-
			    ples/grch38#chr8_36353854-36453166.vcf",
			    ext="vcf") output in vcfwave_4.vcf

./vcfwave -L 10000 ../samples/grch38#chr4_10083863-10181258.vcf	>  ../test/da-
       ta/regression/vcfwave_5.vcf
			    run_stdout("vcfwave	     -L	     10000     ../sam-
			    ples/grch38#chr4_10083863-10181258.vcf",
			    ext="vcf") output in vcfwave_5.vcf

./vcfwave -L  10000  ../samples/test_variant_drop.vcf  >  ../test/data/regres-
       sion/vcfwave_6.vcf
			    run_stdout("vcfwave	-L 10000 ../samples/test_vari-
			    ant_drop.vcf", ext="vcf") output in	vcfwave_6.vcf

	      ## Inversions

	      We can also handle inversions.
	      This test	case includes one that was introduced by building a variation graph with an inversion and then decomposing it into a VCF with `vg deconstruct` and finally "popping" the inversion variant with	[`vcfbub`](https://github.com/pangenome/vcfbub).

	      From

       a 281 >1>9 AGCCGGGGCAGAAAGTTCTTCCTTGAATGTGGTCATCTGCATTTCAGCTCAGGAATCCT-
       GCAAAAGACAG   CTGTCTTTTGCAGGATTCCTGTGCTGAAATGCAGATGACCGCATTCAAGGAAGAAC-
       TATCTGCCCCGGCT				60			     .
       AC=1;AF=1;AN=1;AT=>1>2>3>4>5>6>7>8>9,>1<8>10<6>11<4>12<2>9;NS=1;LV=0 GT
       1

	      To

	      ```python
	      >>> sh("../build/vcfwave ../samples/inversion.vcf|grep INV")
	      ##INFO=<ID=INV,Number=0,Type=Flag,Description="Inversion detected">
	      a	      281     >1>9    AGCCGGGGCAGAAAGTTCTTCCTTGAATGTGGTCATCTGCATTTCAGCTCAGGAATCCTGCAAAAGACAG  CTGTCTTTTGCAGGATTCCTGTGCTGAAATGCAGATGACCGCATTCAAGGAAGAACTATCTGCCCCGGCT  60      .	      AC=1;AF=1.000000;AN=1;AT=>1>2>3>4>5>6>7>8>9;NS=1;LV=0;LEN=70;INV=YES;TYPE=mnp  GT	     1

       Note the	`INV=YES' info.

LICENSE
       Copyright 2022-2024 (C) Erik Garrison, Pjotr Prins and vcflib contribu-
       tors.  MIT licensed.

AUTHORS
       Erik Garrison, Pjotr Prins and other vcflib contributors.

vcfwave	(vcflib)						    VCFWAVE(1)

Want to link to this manual page? Use this URL:
<https://man.freebsd.org/cgi/man.cgi?query=vcfwave&sektion=1&manpath=FreeBSD+Ports+15.0.quarterly>

home | help