VCFWAVE(1) vcfwave (VCF transformation) VCFWAVE(1) NAME vcfwave - reduces complex alleles by pairwise alignment with BiWFA SYNOPSIS vcfwave DESCRIPTION vcfwave reduces complex alleles into simpler primitive representation using pairwise alignment with BiWFA. Often variant callers are not perfect. vcfwave with its companion tool vcfcreatemulti can take an existing VCF file that contains multiple complex overlapping and even nested alleles and, like Humpty Dumpty, can take them apart and put them together again in a more sane VCF output. Thereby get- ting rid of false positives and often greatly simplifying the output. We created these tools for the output from long-read pangenome genotypers - with 10K base pair realignments - and is used in the Human Pangenome Refer- ence Consortium analyses (HPRC). vcfwave realigns reference and alternate alleles with the recently intro- duced super fast bi-wavefront aligner (WFA). vcfwave parses out the origi- nal `primitive' alleles into multiple VCF records and vcfcreatemulti puts them together again. These tools can handle insertions, deletions, inver- sions and nested sequences. In both tools information is tracked on origi- nal positions and genotypes are handled. New records have IDs that refer- ence the source record ID. Deletion alleles will result in haploid (miss- ing allele) genotypes overlapping the deleted region. A typical workflow will call vcfwave to realign all ALT alleles against the reference and spit out simplified VCF records. Next use a tool such as bcftools norm -m- to normalise the VCF records and split out multiple ALT alleles into separate VCF records. Finally use vcfcreatemulti to create multi-allele VCF records again. PERFORMANCE: Unlike traditional aligners that run in quadratic time, the recently intro- duced wavefront aligner WFA runs in time O(ns+s^2), proportional to the se- quence length n and the alignment score s, using O(s^2) memory (or O(s) us- ing the ultralow/BiWFA mode). Therefore WFA does not choke on longer alignments. Speed-wise vcfwave can still be faster. See also the performance docs for some metrics and discussion. READING: See also the humpty dumpty companion tool vcfcreatemulti. Options -h, -help shows help message and exits. See more below. EXIT VALUES 0 Success not 0 Failure EXAMPLES Current command line options: >>> head("vcfwave -h",26) > usage: vcfwave [options] [file] > Realign reference and alternate alleles with WFA, parsing out the 'primitive' alleles into multiple VCF records. New records have IDs that reference the source record ID. Genotypes/samples are handled correctly. Deletions generate haploid/missing genotypes at overlapping sites. > options: -p, --wf-params PARAMS use the given BiWFA params (default: 0,19,39,3,81,1) format=match,mismatch,gap1-open,gap1-ext,gap2-open,gap2-ext -f, --tag-parsed FLAG Annotate decomposed records with the source record position (default: ORIGIN). -L, --max-length LEN Do not manipulate records in which either the ALT or REF is longer than LEN (default: unlimited). -K, --inv-kmer K Length of k-mer to use for inversion detection sketching (default: 17). -I, --inv-min LEN Minimum allele length to consider for inverted alignment (default: 64). -t, --threads N Use this many threads for variant decomposition (default is 1). For most datasets threading may actually slow vcfwave down. --quiet Do not display progress bar. -d, --debug Debug mode. > Note the -k,--keep-info switch is no longer in use and ignored. > Type: transformation vcfwave picks complex regions and simplifies nested alignments. For exam- ple: >>> sh("grep 10158243 ../samples/10158243.vcf") grch38#chr4 10158243 >3655>3662 ACCCCCACCCCCACC ACC,AC,ACCCCCACCCCCAC,ACCCCCACC,ACA 60 . AC=64,3,2,3,1;AF=0.719101,0.0337079,0.0224719,0.0337079,0.011236;AN=89;AT=>3655>3656>3657>3658>3659>3660>3662,>3655>3656>3660>3662,>3655>3660>3662,>3655>3656>3657>3658>3660>3662,>3655>3656>3657>3660>3662,>3655>3656>3661>3662;NS=45;LV=0 GT 0|0 1|1 1|1 1|0 5|1 0|4 0|1 0|1 1|1 1|1 1|1 1|1 1|1 1|1 1|1 4|3 1|1 1|1 1|1 1|0 1|0 1|0 1|0 1|1 1|1 1|4 1|1 1|1 3|0 1|0 1|1 0|1 1|1 1|1 2|1 1|2 1|1 1|1 0|1 1|1 1|1 1|0 1|2 1|1 0 This aligns and adjusts the genotypes accordingly splitting into multiple records, one for each unique allele found in the alignments: >>> sh("../build/vcfwave -L 1000 ../samples/10158243.vcf|grep -v ^\#") grch38#chr4 10158244 >3655>3662_1 CCCCCACCCCCAC C 60 . AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;TYPE=del GT 0|0 0|0 0|0 0|0 1|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0 grch38#chr4 10158244 >3655>3662_2 CCCCCACCCCCACC C 60 . AC=3;AF=0.033708;AN=89;AT=>3655>3656>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=13;TYPE=del GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0 grch38#chr4 10158245 >3655>3662_3 CCCCACCCCCACC C 60 . AC=64;AF=0.719101;AN=89;AT=>3655>3656>3657>3658>3659>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;TYPE=del GT 0|0 1|1 1|1 1|0 0|1 0|0 0|1 0|1 1|1 1|1 1|1 1|1 1|1 1|1 1|1 0|0 1|1 1|1 1|1 1|0 1|0 1|0 1|0 1|1 1|1 1|0 1|1 1|1 0|0 1|0 1|1 0|1 1|1 1|1 0|1 1|0 1|1 1|1 0|1 1|1 1|1 1|0 1|0 1|1 0 grch38#chr4 10158251 >3655>3662_4 CCCCACC C 60 . AC=3;AF=0.033708;AN=89;AT=>3655>3656>3657>3658>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=6;TYPE=del GT 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0 grch38#chr4 10158256 >3655>3662_5 CC C 60 . AC=2;AF=0.022472;AN=89;AT=>3655>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;TYPE=del GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0 grch38#chr4 10158257 >3655>3662_6 C A 60 . AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;TYPE=snp GT 0|0 .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. 0 ./vcfwave -L 10000 ../samples/grch38#chr8_36353854-36453166.vcf > ../test/data/regression/vcfwave_4.vcf run_stdout("vcfwave -L 10000 ../sam- ples/grch38#chr8_36353854-36453166.vcf", ext="vcf") output in vcfwave_4.vcf ./vcfwave -L 10000 ../samples/grch38#chr4_10083863-10181258.vcf > ../test/data/regression/vcfwave_5.vcf run_stdout("vcfwave -L 10000 ../sam- ples/grch38#chr4_10083863-10181258.vcf", ext="vcf") output in vcfwave_5.vcf ./vcfwave -L 10000 ../samples/test_variant_drop.vcf > ../test/data/regres- sion/vcfwave_6.vcf run_stdout("vcfwave -L 10000 ../samples/test_vari- ant_drop.vcf", ext="vcf") output in vcfwave_6.vcf ## Inversions We can also handle inversions. This test case includes one that was introduced by building a variation graph with an inversion and then decomposing it into a VCF with `vg deconstruct` and finally "popping" the inversion variant with [`vcfbub`](https://github.com/pangenome/vcfbub). From a 281 >1>9 AGCCGGGGCAGAAAGTTCTTCCTTGAATGTGGTCATCTGCATTTCAGCTCAGGAATCCTG- CAAAAGACAG CTGTCTTTTGCAGGATTCCTGTGCTGAAATGCAGATGACCGCATTCAAGGAAGAACTATCTGC- CCCGGCT 60 . AC=1;AF=1;AN=1;AT=>1>2>3>4>5>6>7>8>9,>1<8>10<6>11<4>12<2>9;NS=1;LV=0 GT 1 To ```python >>> sh("../build/vcfwave ../samples/inversion.vcf|grep INV") ##INFO=<ID=INV,Number=0,Type=Flag,Description="Inversion detected"> a 281 >1>9 AGCCGGGGCAGAAAGTTCTTCCTTGAATGTGGTCATCTGCATTTCAGCTCAGGAATCCTGCAAAAGACAG CTGTCTTTTGCAGGATTCCTGTGCTGAAATGCAGATGACCGCATTCAAGGAAGAACTATCTGCCCCGGCT 60 . AC=1;AF=1.000000;AN=1;AT=>1>2>3>4>5>6>7>8>9;NS=1;LV=0;LEN=70;INV=YES;TYPE=mnp GT 1 Note the `INV=YES' info. LICENSE Copyright 2022-2024 (C) Erik Garrison, Pjotr Prins and vcflib contributors. MIT licensed. AUTHORS Erik Garrison, Pjotr Prins and other vcflib contributors. vcfwave (vcflib) VCFWAVE(1)
NAME | SYNOPSIS | DESCRIPTION | EXIT VALUES | EXAMPLES | ./vcfwave -L 10000 ../samples/grch38#chr8_36353854-36453166.vcf > | ./vcfwave -L 10000 ../samples/grch38#chr4_10083863-10181258.vcf > | ./vcfwave -L 10000 ../samples/test_variant_drop.vcf > ../test/data/regres- | LICENSE | AUTHORS
Want to link to this manual page? Use this URL:
<https://man.freebsd.org/cgi/man.cgi?query=vcfwave&sektion=1&manpath=FreeBSD+Ports+15.1.quarterly>