Skip site navigation (1)Skip section navigation (2)

FreeBSD Manual Pages

  
 
  

home | help
RNAFOLD(1)			 User Commands			    RNAFOLD(1)

NAME
       RNAfold - manual	page for RNAfold 2.7.0

SYNOPSIS
       RNAfold [OPTIONS] [<input0.fa>] [<input1.fa>]...

DESCRIPTION
       RNAfold 2.7.0

       Calculate  minimum free energy secondary	structures and partition func-
       tion of RNAs

       The program reads RNA sequences,	calculates their minimum  free	energy
       (mfe)  structure	 and  prints the mfe structure in bracket notation and
       its free	energy.	 If not	specified differently using commandline	 argu-
       ments,  input  is  accepted  from stdin or read from an input file, and
       output printed to stdout. If the	-p option was given it	also  computes
       the  partition  function	 (pf) and base pairing probability matrix, and
       prints the free energy of the thermodynamic ensemble, the frequency  of
       the  mfe	 structure in the ensemble, and	the ensemble diversity to std-
       out.

       It also produces	PostScript files with plots of the resulting secondary
       structure graph and a "dot plot"	of the base pairing matrix.   The  dot
       plot  shows  a  matrix of squares with area proportional	to the pairing
       probability in the upper	right half, and	one square for	each  pair  in
       the minimum free	energy structure in the	lower left half. For each pair
       i-j with	probability p>10E-6 there is a line of the form

       i  j  sqrt(p)  ubox

       in  the	PostScript  file, so that the pair probabilities can be	easily
       extracted.

       Sequences may be	provided in a simple text format where	each  sequence
       occupies	 a  single line. Output	files are named	"rna.ps" and "dot.ps".
       Existing	files of the same name will be overwritten.

       It is also possible to provide sequence data in FASTA format.  In  this
       case,  the  first  word	of the FASTA header will be used as prefix for
       output file names.  PostScript files "prefix_ss.ps" and	"prefix_dp.ps"
       are  produced  for the structure	and dot	plot, respectively. Note, how-
       ever, that once FASTA input was provided	all following  sequences  must
       be in FASTA format too.

       To  avoid  problems  with certain operating systems and/or file systems
       the prefix will ALWAYS be sanitized! This step substitutes any  special
       character in the	prefix by a filename delimiter.	See the	--filename-de-
       lim  option  to	change	the delimiting character according to your re-
       quirements.

       The program will	continue to read new sequences until a line consisting
       of the single character '@' or an end of	file (EOF)  condition  is  en-
       countered.

       -h, --help
	      Print help and exit

       --detailed-help
	      Print help, including all	details	and hidden options, and	exit

       --full-help
	      Print help, including hidden options, and	exit

       -V, --version
	      Print version and	exit

       -v, --verbose
	      Be verbose.  (default=off)

	      Lower  the  log  level  setting such that	even INFO messages are
	      passed through.

   I/O Options:
	      Command line options for input and output	(pre-)processing

       -i, --infile=filename
	      Read a file instead of reading from stdin.

	      The default behavior of RNAfold is to read input from  stdin  or
	      the file(s) that follow(s) the RNAfold command. Using this para-
	      meter  the  user can specify input file names where data is read
	      from. Note, that any additional files supplied  to  RNAfold  are
	      still processed as well.

       -o, --outfile[=filename]
	      Print output to file instead of stdout.

	      This  option  may	 be  used  to write all	output to output files
	      rather  than  printing  to  stdout.  The	default	 filename   is
	      "RNAfold_output.fold"  if	no FASTA header	precedes the input se-
	      quences and the --auto-id	feature	is inactive. Otherwise,	output
	      files with the scheme "prefix.fold"  are	generated,  where  the
	      "prefix"	is  taken from the sequence id,	e.g. the FASTA header.
	      The user may specify a single output file	name for all data gen-
	      erated from the input by supplying a filename as	argument  fol-
	      lowing  immediately  after  this parameter.  In case a file with
	      the same filename	already	exists,	any output of the program will
	      be appended to it. Note: Any special characters in the  filename
	      will  be	replaced  by the filename delimiter, hence there is no
	      way to pass an entire directory path through this	option	(yet).
	      (See also	the "--filename-delim" parameter)

       -j, --jobs[=number]
	      Split batch input	into jobs and start processing in parallel us-
	      ing multiple threads. A value of 0 indicates to use as many par-
	      allel threads as computation cores are available.

	      (default=`0')

	      Default  processing of input data	is performed in	a serial fash-
	      ion, i.e.	one sequence at	a time.	Using this switch, a user  can
	      instead start the	computation for	many sequences in the input in
	      parallel.	RNAfold	will create as many parallel computation slots
	      as specified and assigns input sequences of the input file(s) to
	      the  available  slots. Note, that	this increases memory consump-
	      tion since input alignments have to be kept in memory  until  an
	      empty  compute  slot  is available and each running job requires
	      its own dynamic programming matrices.

       --unordered
	      Do not try to keep output	in order  with	input  while  parallel
	      processing is in place.

	      (default=off)

	      When parallel input processing (--jobs flag) is enabled, the or-
	      der in which input is processed depends on the host machines job
	      scheduler. Therefore, any	output to stdout or files generated by
	      this program will	most likely not	follow the order of the	corre-
	      sponding input data set. The default of RNAfold is to use	a spe-
	      cialized	data structure to still	keep the results output	in or-
	      der with the input data. However,	this comes with	a trade-off in
	      terms of memory consumption, since all output must  be  kept  in
	      memory  for  as long as no chunks	of consecutive,	ordered	output
	      are available. By	setting	this flag, RNAfold will	not buffer in-
	      dividual results but print them as soon as they have been	compu-
	      tated.

       --noconv
	      Do not automatically substitute nucleotide "T" with "U".

	      (default=off)

       --auto-id
	      Automatically generate an	ID for each sequence.  (default=off)

	      The default mode of RNAfold is to	automatically determine	an  ID
	      from  the	input sequence data if the input file format allows to
	      do that. Sequence	IDs are	usually	given in the FASTA  header  of
	      input sequences. If this flag is active, RNAfold ignores any IDs
	      retrieved	 from  the input and automatically generates an	ID for
	      each sequence. This ID consists of a prefix  and	an  increasing
	      number.  This flag can also be used to add a FASTA header	to the
	      output even if the input has none.

       --id-prefix=STRING
	      Prefix for automatically generated IDs (as used in  output  file
	      names).

	      (default=`sequence')

	      If  this	parameter  is set, each	sequence will be prefixed with
	      the provided string. Hence, the output files will	obey the  fol-
	      lowing  naming  scheme: "prefix_xxxx_ss.ps" (secondary structure
	      plot),  "prefix_xxxx_dp.ps"   (dot-plot),	  "prefix_xxxx_dp2.ps"
	      (stack  probabilities),  etc. where xxxx is the sequence number.
	      Note: Setting this parameter implies --auto-id.

       --id-delim=CHAR
	      Change the delimiter between prefix and  increasing  number  for
	      automatically generated IDs (as used in output file names).

	      (default=`_')

	      This  parameter  can be used to change the default delimiter "_"
	      between the prefix string	and the	increasing number for automat-
	      ically generated ID.

       --id-digits=INT
	      Specify the number of digits of  the  counter  in	 automatically
	      generated	alignment IDs.

	      (default=`4')

	      When alignments IDs are automatically generated, they receive an
	      increasing  number,  starting with 1. This number	will always be
	      left-padded by leading zeros, such that the number  takes	 up  a
	      certain  width. Using this parameter, the	width can be specified
	      to the users need. We allow numbers in the  range	 [1:18].  This
	      option implies --auto-id.

       --id-start=LONG
	      Specify the first	number in automatically	generated IDs.

	      (default=`1')

	      When  sequence  IDs are automatically generated, they receive an
	      increasing number, usually starting with 1. Using	 this  parame-
	      ter,  the	 first	number	can be specified to the	users require-
	      ments. Note: negative numbers are	not  allowed.	Note:  Setting
	      this  parameter implies to ignore	any IDs	retrieved from the in-
	      put data,	i.e. it	activates the --auto-id	flag.

       --filename-delim=CHAR
	      Change the delimiting character used in sanitized	filenames.

	      (default=`ID-delimiter')

	      This parameter can be used to change  the	 delimiting  character
	      used  while sanitizing filenames,	i.e. replacing invalid charac-
	      ters. Note, that the default delimiter ALWAYS is the first char-
	      acter of the "ID delimiter" as supplied through  the  --id-delim
	      option. If the delimiter is a whitespace character or empty, in-
	      valid characters will be simply removed rather than substituted.
	      Currently, we regard the following characters as illegal for use
	      in  filenames: backslash '\', slash '/', question	mark '?', per-
	      cent sign	'%', asterisk '*', colon ':', pipe symbol '|',	double
	      quote '"', triangular brackets '<' and '>'.

       --filename-full
	      Use full FASTA header to create filenames.  (default=off)

	      This parameter can be used to deactivate the default behavior of
	      limiting	output filenames to the	first word of the sequence ID.
	      Consider the following  example:	An  input  with	 FASTA	header
	      '>NM_0001	 Homo Sapiens some gene' usually produces output files
	      with the prefix "NM_0001"	without	the additional data  available
	      in  the  FASTA header, e.g. "NM_0001_ss.ps" for secondary	struc-
	      ture plots. With this flag set,  no  truncation  of  the	output
	      filenames	 is done, i.e. output filenames	receive	the full FASTA
	      header data as prefixes. Note, however, that invalid  characters
	      (such as whitespace) will	be substituted by a delimiting charac-
	      ter  or  simply  removed,	(see also the parameter	option --file-
	      name-delim).

       --log-level=level
	      Set log level threshold.	(default=`2')

	      By default, any log messages are filtered	such that  only	 warn-
	      ings (level 2) or	errors (level 3) are printed. This setting al-
	      lows for specifying the log level	threshold, where higher	values
	      result in	fewer information. Log-level 5 turns off all messages,
	      even errors and other critical information.

       --log-file[=filename]
	      Print   log   messages  to  a  file  instead  of	stderr.	  (de-
	      fault=`RNAfold.log')

       --log-time
	      Include time stamp in log	messages.

	      (default=off)

       --log-call
	      Include file and line of log calling function.

	      (default=off)

   Algorithms:
	      Select additional	algorithms which should	 be  included  in  the
	      calculations.   The  Minimum  free  energy (MFE) and a structure
	      representative are calculated in any case.

       -p, --partfunc[=INT]
	      Calculate	the partition function and  base  pairing  probability
	      matrix.

	      (default=`1')

	      In  addition  to the MFE structure we print a coarse representa-
	      tion of the pair probabilities in	form of	a pseudo bracket nota-
	      tion followed by the ensemble free energy. This  notation	 makes
	      use  of the letters '.', ',', '|', '{', '}', '(',	and ')'	denot-
	      ing bases	that are essentially unpaired, weakly paired, strongly
	      paired without preference, weakly	upstream (downstream)  paired,
	      or strongly up- (down-)stream paired bases, respectively.	On the
	      next line	the centroid structure as derived from the pair	proba-
	      bilities	together  with its free	energy and distance to the en-
	      semble is	shown. Finally it prints  the  frequency  of  the  mfe
	      structure,  and  the structural diversity	(mean distance between
	      the  structures  in  the	ensemble).   See  the  description  of
	      'vrna_pf()'  and	'mean_bp_dist()'  and 'vrna_centroid()'	in the
	      RNAlib documentation for details.	 Note  that  unless  you  also
	      specify  -d2 or -d0, the partition function and mfe calculations
	      will use a slightly different energy model. See  the  discussion
	      of dangling end options below.

	      An additionally passed value to this option changes the behavior
	      of  partition  function calculation: -p0 Calculate the partition
	      function but not the pair	probabilities,	saving	about  50%  in
	      runtime.	This  prints  the ensemble free	energy 'dG=-kT ln(Z)'.
	      -p2 Compute stack	probabilities, i.e.  the  probability  that  a
	      pair  '(i,j)'  and the immediately enclosed pair '(i+1,j-1)' are
	      formed simultaneously in addition	to pair	probabilities. A  sec-
	      ond  postscript  dot  plot named "name_dp2.ps", or "dot2.ps" (if
	      the sequence does	not have a name), is  produced	that  contains
	      pair  probabilities in the upper right half and stack probabili-
	      ties in the lower	left.

       --betaScale=DOUBLE
	      Set the scaling of the Boltzmann factors.	 (default=`1.')

	      The argument provided with this option  is  used	to  scale  the
	      thermodynamic temperature	in the Boltzmann factors independently
	      from  the	 temperature  of  the individual loop energy contribu-
	      tions. The Boltzmann factors then	 become	 'exp(-	 dG/(kT*betaS-
	      cale))'  where  'k' is the Boltzmann constant, 'dG' the free en-
	      ergy contribution	of the state and 'T' the absolute temperature.

       -S, --pfScale=DOUBLE
	      In the calculation of the	pf use scale*mfe as  an	 estimate  for
	      the ensemble free	energy (used to	avoid overflows).

	      (default=`1.07')

	      The  default is 1.07, useful values are 1.0 to 1.2. Occasionally
	      needed for long sequences.

       --MEA[=gamma]
	      Compute MEA (maximum expected accuracy) structure.

	      (default=`1.')

	      The expected accuracy is computed	from the  pair	probabilities:
	      each  base  pair '(i,j)' receives	a score	'2*gamma*p_ij' and the
	      score of an unpaired base	is given by  the  probability  of  not
	      forming a	pair. The parameter gamma tunes	the importance of cor-
	      rectly  predicted	 pairs	versus unpaired	bases. Thus, for small
	      values of	gamma the MEA structure	will contain only  pairs  with
	      very  high probability. Using --MEA implies -p for computing the
	      pair probabilities.

       -c, --circ
	      Assume a circular	(instead of linear) RNA	molecule.

	      (default=off)

       --ImFeelingLucky
	      Return exactly one stochastically	backtracked structure.

	      (default=off)

	      This function computes the partition function  and  returns  ex-
	      actly  one  secondary  structure stochastically sampled from the
	      Boltzmann	equilibrium according to its probability in the	ensem-
	      ble

       --bppmThreshold=cutoff
	      Set the threshold/cutoff for base	pair probabilities included in
	      the postscript output.

	      (default=`1e-5')

	      By setting the threshold the base	pair  probabilities  that  are
	      included	in the output can be varied. By	default	only those ex-
	      ceeding '1e-5' in	probability will be shown as  squares  in  the
	      dot  plot.  Changing the threshold to any	other value allows for
	      increase or decrease of data.

       -g, --gquad
	      Incoorporate G-Quadruplex	formation into the  structure  predic-
	      tion algorithm.

	      (default=off)

   Structure Constraints:
	      Command  line options to interact	with the structure constraints
	      feature of this program

       --maxBPspan=INT
	      Set the maximum base pair	span.

	      (default=`-1')

       -C, --constraint[=filename]
	      Calculate	structures subject to constraints.  (default=`')

	      The program reads	first the sequence, then a  string  containing
	      constraints on the structure encoded with	the symbols:

	      '.' (no constraint for this base)

	      '|' (the corresponding base has to be paired

	      'x' (the base is unpaired)

	      '<' (base	i is paired with a base	j>i)

	      '>' (base	i is paired with a base	j<i)

	      and matching brackets '('	')' (base i pairs base j)

	      With  the	 exception of '|', constraints will disallow all pairs
	      conflicting with the constraint. This is usually	sufficient  to
	      enforce  the  constraint,	 but  occasionally a base may stay un-
	      paired in	spite of constraints. PF folding  ignores  constraints
	      of type '|'.

       --batch
	      Use constraints for multiple sequences.  (default=off)

	      Usually,	constraints  provided  from input file only apply to a
	      single input sequence. Therefore,	RNAfold	will stop its computa-
	      tion and quit after the first input sequence was processed.  Us-
	      ing  this	switch,	RNAfold	processes multiple input sequences and
	      applies the same provided	constraints to each of them.

       --canonicalBPonly
	      Remove non-canonical base	pairs from the structure constraint.

	      (default=off)

       --enforceConstraint
	      Enforce base pairs given by round	brackets '(' ')' in  structure
	      constraint.

	      (default=off)

       --shape=filename
	      Use SHAPE	reactivity data	to guide structure predictions.

       --shapeMethod=method
	      Select SHAPE reactivity data incorporation strategy.

	      (default=`D')

	      The  following methods can be used to convert SHAPE reactivities
	      into pseudo energy contributions.

	      'D': Convert by using the	linear equation	according to Deigan et
	      al 2009.

	      Derived pseudo energy terms will be applied for every nucleotide
	      involved in a stacked pair. This method is recognized by a capi-
	      tal 'D' in the provided parameter,  i.e.:	 --shapeMethod="D"  is
	      the  default setting. The	slope 'm' and the intercept 'b'	can be
	      set to a non-default value if  necessary,	 otherwise  m=1.8  and
	      b=-0.6.  To alter	these parameters, e.g. m=1.9 and b=-0.7, use a
	      parameter	string like this: --shapeMethod="Dm1.9b-0.7". You  may
	      also   provide   only   one   of	 the   two   parameters	 like:
	      --shapeMethod="Dm1.9" or --shapeMethod="Db-0.7".

	      'Z': Convert SHAPE reactivities to pseudo	energies according  to
	      Zarringhalam

	      et  al  2012.  SHAPE  reactivities  will be converted to pairing
	      probabilities by using linear mapping. Aberration	from  the  ob-
	      served  pairing probabilities will be penalized during the fold-
	      ing recursion. The magnitude of the penalties  can  affected  by
	      adjusting	the factor beta	(e.g. --shapeMethod="Zb0.8").

	      'W':  Apply  a given vector of perturbation energies to unpaired
	      nucleotides

	      according	to Washietl et al 2012.	Perturbation  vectors  can  be
	      calculated by using RNApvmin.

       --shapeConversion=method
	      Select method for	SHAPE reactivity conversion.

	      (default=`O')

	      This  parameter is useful	when dealing with the SHAPE incorpora-
	      tion according to	Zarringhalam et	al. The	following methods  can
	      be used to convert SHAPE reactivities into the probability for a
	      certain nucleotide to be unpaired.

	      'M':  Use	 linear	mapping	according to Zarringhalam et al.  'C':
	      Use a cutoff-approach to divide into  paired  and	 unpaired  nu-
	      cleotides	 (e.g.	"C0.25")  'S': Skip the	normalizing step since
	      the input	data already represents	probabilities  for  being  un-
	      paired rather than raw reactivity	values 'L': Use	a linear model
	      to  convert the reactivity into a	probability for	being unpaired
	      (e.g. "Ls0.68i0.2" to use	a slope	of 0.68	and  an	 intercept  of
	      0.2)  'O': Use a linear model to convert the log of the reactiv-
	      ity into a probability for being unpaired	(e.g. "Os1.6i-2.29" to
	      use a slope of 1.6 and an	intercept of -2.29)

       --motif=SEQUENCE,STRUCTURE,ENERGY
	      Specify stabilizing energy of a ligand binding

	      to a particular sequence/structure motif.

	      Some ligands binding to RNAs require  and/or  induce  particular
	      sequence	and structure motifs. For instance they	bind to	an in-
	      ternal loop, or small hairpin loop. If for such cases a  binding
	      free  energy is known, the binding and therefore stabilizing ef-
	      fect of the ligand can be	included in  the  folding  recursions.
	      Interior	loop  motifs are specified as concatenations of	5' and
	      3' motif,	separated by an	'&' character.

	      Energy contributions must	be specified in	kcal/mol.

	      See the manpage for an example usage of this option.

       --commands=filename
	      Read additional commands from file

	      Commands include hard and	soft constraints, but  also  structure
	      motifs  in  hairpin  and	internal loops that need to be treeted
	      differently. Furthermore,	commands can be	set  for  unstructured
	      and structured domains.

   Energy Parameters:
	      Energy  parameter	 sets  can be adapted or loaded	from user-pro-
	      vided input files

       -T, --temp=DOUBLE
	      Rescale energy parameters	to a temperature of temp C. Default is
	      37C.

	      (default=`37.0')

       -P, --paramFile=paramfile
	      Read energy parameters from paramfile, instead of	using the  de-
	      fault parameter set.

	      Different	 sets  of energy parameters for	RNA and	DNA should ac-
	      company your distribution.  See the RNAlib documentation for de-
	      tails on the file	format.	The placeholder	file name 'DNA'	can be
	      used to load DNA parameters without the need to actually specify
	      any input	file.

       -4, --noTetra
	      Do not include special tabulated stabilizing energies for	 tri-,
	      tetra- and hexaloop hairpins.

	      (default=off)

	      Mostly for testing.

       --salt=DOUBLE
	      Set salt concentration in	molar (M). Default is 1.021M.

       -m, --modifications[=STRING]
	      Allow for	modified bases within the RNA sequence string.

	      (default=`7I6P9D')

	      Treat  modified  bases within the	RNA sequence differently, i.e.
	      use corresponding	 energy	 corrections  and/or  pairing  partner
	      rules  if	 available.  For that, the modified bases in the input
	      sequence must be marked by their corresponding one-letter	 code.
	      If  no  additional arguments are supplied, all available correc-
	      tions are	performed. Otherwise, the user may limit the modifica-
	      tions to a particular subset of modifications, resp.  one-letter
	      codes,  e.g.  -mP6  will	only correct for pseudouridine and m6A
	      bases.

	      Currently	supported one-letter codes and energy corrections are:

	      '7': 7-deaza-adenonsine (7DA)

	      'I': Inosine

	      '6': N6-methyladenosine (m6A)

	      'P': Pseudouridine

	      '9': Purine (a.k.a. nebularine)

	      'D': Dihydrouridine

       --mod-file=STRING
	      Use additional modified base data	from JSON file.

   Model Details:
	      Tweak the	energy model and pairing rules additionally using  the
	      following	parameters

       -d, --dangles=INT
	      How  to  treat "dangling end" energies for bases adjacent	to he-
	      lices in free ends and multi-loops.

	      (default=`2')

	      With -d1 only unpaired bases can participate in at most one dan-
	      gling end.  With -d2 this	check is  ignored,  dangling  energies
	      will be added for	the bases adjacent to a	helix on both sides in
	      any  case;  this	is  the	default	for mfe	and partition function
	      folding (-p).  The option	-d0 ignores dangling  ends  altogether
	      (mostly for debugging).  With -d3	mfe folding will allow coaxial
	      stacking	of  adjacent helices in	multi-loops. At	the moment the
	      implementation will not allow coaxial stacking of	 the  two  en-
	      closed  pairs in a loop of degree	3 and works only for mfe fold-
	      ing.

	      Note that	with -d1 and -d3 only the MFE computations will	be us-
	      ing this setting while partition function	uses -d2 setting, i.e.
	      dangling ends will be treated differently.

       --noLP Produce structures without lonely	pairs (helices of length 1).

	      (default=off)

	      For partition function folding this only	disallows  pairs  that
	      can  only	occur isolated.	Other pairs may	still occasionally oc-
	      cur as helices of	length 1.

       --noGU Do not allow GU pairs.

	      (default=off)

       --noClosingGU
	      Do not allow GU pairs at the end of helices.

	      (default=off)

       --nsp=STRING
	      Allow other pairs	in addition to the usual AU,GC,and GU pairs.

	      Its argument is a	comma separated	list of	 additionally  allowed
	      pairs.  If  the first character is a "-" then AB will imply that
	      AB and BA	are allowed pairs, e.g.	--nsp="-GA"  will allow	GA and
	      AG pairs.	Nonstandard pairs are given 0 stacking energy.

       --energyModel=INT
	      Set energy model.

	      Rarely used option to fold sequences from	the artificial ABCD...
	      alphabet,	where A	pairs B, C-D etc.  Use the  energy  parameters
	      for GC (--energyModel 1) or AU (--energyModel 2) pairs.

       --helical-rise=FLOAT
	      Set the helical rise of the helix	in units of Angstrom.

	      (default=`2.8')

	      Use with caution!	This value will	be re-set automatically	to 3.4
	      in  case	DNA  parameters	 are  loaded via -P DNA	and no further
	      value is provided.

       --backbone-length=FLOAT
	      Set the average backbone length for looped regions in  units  of
	      Angstrom.

	      (default=`6.0')

	      Use  with	 caution!  This	 value will be re-set automatically to
	      6.76 in case DNA parameters are loaded via -P DNA	and no further
	      value is provided.

   Plotting:
	      Command line options for changing	the default behavior of	struc-
	      ture layout and pairing probability plots

       --noPS Do not produce postscript	drawing	of the mfe structure.

	      (default=off)

       --noDP Do not produce dot-plot postscript file containing base pair  or
	      stack probabilitities.

	      (default=off)

	      In  combination with the -p option, this flag turns-off creation
	      of individual dot-plot files. Consequently, computed  base  pair
	      probability  output  is  omitted	but centroid and MEA structure
	      prediction is still performed.

       -t, --layout-type=INT
	      Choose the layout	algorithm.  (default=`1')

	      Select the layout	algorithm that computes	the nucleotide coordi-
	      nates.  Currently, the following algorithms are available:

	      '0': simple radial layout

	      '1': Naview layout (Bruccoleri et	al. 1988)

	      '2': circular layout

	      '3': RNAturtle (Wiegreffe	et al. 2018)

	      '4': RNApuzzler (Wiegreffe et al.	2018)

REFERENCES
       If you use this program in your work you	might want to cite:

       R. Lorenz, S.H. Bernhart, C.  Hoener  zu	 Siederdissen,	H.  Tafer,  C.
       Flamm,  P.F. Stadler and	I.L. Hofacker (2011), "ViennaRNA Package 2.0",
       Algorithms for Molecular	Biology: 6:26

       I.L. Hofacker, W. Fontana, P.F. Stadler,	S. Bonhoeffer, M.  Tacker,  P.
       Schuster	 (1994),  "Fast	Folding	and Comparison of RNA Secondary	Struc-
       tures", Monatshefte f. Chemie: 125, pp 167-188

       R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding  with  hard
       and soft	constraints", Algorithms for Molecular Biology 11:1 pp 1-13

       M.  Zuker,  P.  Stiegler	(1981),	"Optimal computer folding of large RNA
       sequences using thermodynamic and  auxiliary  information",  Nucl  Acid
       Res: 9, pp 133-148

       J.S.  McCaskill	(1990),	 "The  equilibrium partition function and base
       pair binding probabilities for RNA secondary structures",  Biopolymers:
       29, pp 1105-1119

       I.L.  Hofacker  &  P.F. Stadler (2006), "Memory Efficient Folding Algo-
       rithms for Circular RNA Secondary Structures", Bioinformatics

       A.F. Bompfuenewerer, R. Backofen, S.H. Bernhart,	J.  Hertel,  I.L.  Ho-
       facker,	P.F. Stadler, S. Will (2007), "Variations on {RNA} Folding and
       Alignment: Lessons from Benasque", J. Math. Biol.

       D. Adams	(1979),	"The hitchhiker's guide	to  the	 galaxy",  Pan	Books,
       London

       The calculation of mfe structures is based on dynamic programming algo-
       rithm  originally  developed by M. Zuker	and P. Stiegler. The partition
       function	algorithm is based on work by J.S. McCaskill.

       The energy parameters are taken from:

       D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J.	Schroeder,  J.
       Susan,  M. Zuker, D.H. Turner (2004), "Incorporating chemical modifica-
       tion constraints	into a dynamic programming algorithm for prediction of
       RNA secondary structure", Proc. Natl. Acad. Sci.	USA: 101, pp 7287-7292

       D.H Turner, D.H.	Mathews	(2009),	"NNDB: The nearest neighbor  parameter
       database	for predicting stability of nucleic acid secondary structure",
       Nucleic Acids Research: 38, pp 280-282

EXAMPLES
       Single  line  sequence  input and calculation of	partition function and
       MEA structure

	 $ RNAfold --MEA -d2 -p

       The program will	then prompt for	sequence input.	Using the example  se-
       quence  "CGACGTAGATGCTAGCTGACTCGATGC"  and pressing ENTER the output of
       the program will	be similar to

	 CGACGUAGAUGCUAGCUGACUCGAUGC
	 (((.((((.......)).)))))....
	  minimum free energy =	 -1.90 kcal/mol
	 (((.((((.......))},})))....
	  free energy of ensemble =  -2.86 kcal/mol
	 (((.(.((.......))..)))).... {	0.80 d=2.81}
	 (((.((((.......))).)))).... { -1.90 MEA=22.32}
	  frequency of mfe structure in	ensemble 0.20997; ensemble diversity 4.19

       Here, the first line just repeats the sequence input. The  second  line
       contains	 a MFE structure in dot	bracket	notation followed by the mini-
       mum free	energy.	After this, the	pairing	 probabilities	for  each  nu-
       cleotide	 are  shown  in	 a pseudo dot-bracket notation followed	by the
       free energy of ensemble.	The next two lines show	the centroid structure
       with its	free energy and	its distance to	the ensemble as	 well  as  the
       MEA  structure,	its free energy	and the	maximum	expected accuracy, re-
       spectively. The last line finally contains the  frequency  of  the  MFE
       representative in the complete ensemble of secondary structures and the
       ensemble	 diversity.  For further details about the calculation and in-
       terpretation of the given output	 refer	to  the	 reference  manual  of
       RNAlib.

       Since  version  2.0  it is also possible	to provide FASTA file sequence
       input. Assume you have a	file containing	two sequences in FASTA format,
       e.g

	 $ cat sequences.fa
	 >seq1
	 CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
	 GAACGAUCUAUAACACGACUUCACUCUU
	 >seq2
	 GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUA
	 UAACACGACUUCACUCUU

       In order	to compute the MFE for the two sequences the user can use  the
       following command

	 $ RNAfold < sequences.fa

       which would result in an	output like this

	 >seq1
	 CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
	 .((.(((...((((..(((((........)))))))))...))).))................... ( -5.40)
	 >seq2
	 GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
	 .......((((..............))))........................... ( -2.00)

CONSTRAINT EXAMPLES
       Secondary  structure  constraints  may  be given	in addition to the se-
       quence information, too.	 Using the first sequence of the previous  ex-
       ample  and restricting the nucleotides of the outermost helix to	be un-
       paired, i.e. base pairs (2,47) and (3,46) the input  file  should  have
       the following form

	 $ cat sequence_unpaired.fa
	 >seq1
	 CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
	 GAACGAUCUAUAACACGACUUCACUCUU
	 .xx...................................
	 .......xx...................

       Calling	RNAfold	 with  the structure constraint	option -C it shows the
       following result

	 $ RNAfold -C <	sequence_unpaired.fa
	 >seq1
	 CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
	 ....(((...((((..(((((........)))))))))...)))...................... ( -4.20)

       This represents the minimum free	energy and a structure	representative
       of  the	RNA  sequence given that nucleotides 2,3,46 and	47 must	not be
       involved	in any base pair.  For further information  about  constrained
       folding	refer to the details of	the -C option and the reference	manual
       of RNAlib.

       Since version 2.2 the ViennaRNA Package	distinguishes  hard  and  soft
       constraints.   As  a  consequence,  structure  predictions  are	easily
       amenable	to a versatile set of constraints, such	as maximal  base  pair
       span, incorporation of SHAPE reactivity data, and RNA-ligand binding to
       hairpin,	or interior loop motifs.

       Restricting the maximal span of a base pair

       A  convenience  commandline  option allows you to easily	limit the dis-
       tance (j	- i + 1) between two nucleotides i and j that form a basepair.
       For instance a limit of 600nt can be accomplished using:

	 $ RNAfold --maxBPspan 600

       Guide structure prediction with SHAPE reactivity	data

       Use SHAPE reactivity data to guide secondary structure prediction:

	 $ RNAfold --shape=reactivities.dat < sequence.fa

       where the file reactivities.dat is a two	column text file with sequence
       positions (1-based) and normalized reactivity values (usually between 0
       and 2. Missing values may be left out, or assigned a negative score:

	 $ cat reactivities.dat
	 9    -999	 # No reactivity information
	 10   -999
	 11   0.042816	 # normalized SHAPE reactivity
	 12   0		 # also	a valid	SHAPE reactivity
	 15   0.15027	 # Missing data	for pos. 13-14
	 ...
	 42   0.16201

       Note, that RNAfold will only process the	first sequence	in  the	 input
       file, when provided with	SHAPE reactivity data!

       Complex structure constraints and grammar extensions

       Structure constraints beyond those that can be expressed	with a pseudo-
       dot bracket notation may	be provided in a so-called command file:

	 $ RNAfold --commands=constraints.txt <	sequence.fa

       The  command  file syntax is a generalization of	constraints as used in
       UNAfold/mfold. Each line	starts with a one or two letter	 command  fol-
       lowed by	command	parameters. For	structure constraints, this amounts to
       a  single command character followed by three or	four numbers. In addi-
       tion, optional auxiliary	modifier characters may	be used	to  limit  the
       constraint  to specific loop types. For base pair specific constraints,
       we currently distinguish	pairs in exterior loops	(E), closing pairs  of
       hairpin	loops  (H),  closing  (I)  and	enclosed (i) pairs of interior
       loops, and closing (M) and enclosed (m) pairs of	multibranch loops. Nu-
       cleotide-wise constraints may be	limited	to their  loop	context	 using
       the  corresponding uppercase characters.	The default is to apply	a con-
       straint to all (A) loop types.  Furthermore,  pairing  constraints  for
       single  nucleotides  may	 be limited to upstream	(U), or	downstream (D)
       orientation. The	command	file specification is as follows:

	 F i 0 k   [TYPE] [ORIENTATION]	# Force	nucleotides i...i+k-1 to be paired
	 F i j k   [TYPE] # Force helix	of size	k starting with	(i,j) to be formed
	 P i 0 k   [TYPE] # Prohibit nucleotides i...i+k-1 to be paired
	 P i j k   [TYPE] # Prohibit pairs (i,j),...,(i+k-1,j-k+1)
	 P i-j k-l [TYPE] # Prohibit pairing between two ranges
	 C i 0 k   [TYPE] # Nucleotides	i,...,i+k-1 must appear	in context TYPE
	 C i j k	  # Remove pairs conflicting with (i,j),...,(i+k-1,j-k+1)
	 E i 0 k e	  # Add	pseudo-energy e	to nucleotides i...i+k-1
	 E i j k e	  # Add	pseudo-energy e	to pairs (i,j),...,(i+k-1,j-k+1)
	 UD m e	   [LOOP] # Add	ligand binding to unstructured domains with motif
			  # m and binding free energy e

			  # [LOOP]	  = { E, H, I, M, A }
			  # [TYPE]	  = [LOOP] + { i, m }
			  # [ORIENTATION] = { U, D }

       Again, RNAfold by default only processes	the first sequence in the  in-
       put sequence when provided with constraints in a	command	file. To apply
       the  exact  same	 constraints to	each of	the input sequences in a multi
       FASTA file, use the batch mode commandline option:

	 $ RNAfold --constraint=constraints.txt	--batch	< sequences.fa

       Ligand binding contributions to specific	hairpin/interior loop motifs

       A convenience function allows one to specify a  hairping/interior  loop
       motif  where  a ligand is binding with a	particular binding free	energy
       dG.  Here is an example that adds a theophylline	 binding  motif.  Free
       energy  contribution  of	this motif of dG=-9.22kcal/mol is derived from
       k_d=0.32umol/l, taken from Jenison et al.  1994.	Although the structure
       motif consists of a symmetric interior loop of size 6,  followed	 by  a
       small  helix  of	 3 basepairs, and a bulge of 3 nucleotides, the	entire
       structure can still be represented by one interior loop.	 See the below
       mofif description where the '&' character splits	the motif  into	 a  5'
       and  a  3'  part.  The first line gives the sequences motif, the	second
       line shows the actual structure motif of	the aptamer  pocket,  and  the
       third line is the interior loop motif that fully	encapsulates the theo-
       phylline	aptamer:

	 GAUACCAG&CCCUUGGCAGC
	 (...((((&)...)))...)
	 (......(&).........)

       To  use the above information in	the folding recursions of RNAfold, one
       only needs to provide the motif itself, and binding free	energy:

	 $ RNAfold --motif="GAUACCAG&CCCUUGGCAGC,(...((((&)...)))...),-9.22" < sequences.fa

       Adding the --verbose option to the above	call of	 RNAfold  also	prints
       the sequence position of	each motif found in the	MFE structure. In case
       interior-loop  like  motifs are provided, two intervals are printed de-
       noting the 5' and 3' part, respectively.

       Ligand binding contributions to unpaired	segments of the	RNA structure

       The extension of	the RNA	folding	grammar	with unstructured domains  al-
       lows  for  an  easy  incorporation  of  ligands	that  bind to unpaired
       stretches of an RNA structure. To model such interactions only two  pa-
       rameters	 are  required:	 (i)  a	 sequence motif	in IUPAC notation that
       specifies where the ligand binds	to, and	(ii)  a	 binding  free	energy
       that  can  be derived from the association/dissociation constant	of the
       ligand.	With these two parameters in hand, the modification of RNAfold
       to include the competition of regular intramolecular base  pairing  and
       ligand  interaction  is as easy as writing a simple command file	of the
       form:

	 UD m e	   [LOOP]

       where m is the motif string in upper-case IUPAC	notation,  and	e  the
       binding	free  energy  in  kcal/mol  and	optional loop type restriction
       [LOOP]. See also	the command file specification as defined above.

       For instance, having a protein with a  4-nucleotide  footprint  binding
       'AAAA', a binding free energy e = -5.0 kcal/mol,	and a binding restric-
       tion to exterior- and multibranch loops results in a command file:

	 $ cat commands.txt
	 UD AAAA -5.0  ME

       and  the	 corresponding	call to	RNAfold	to compute MFE and equilibrium
       probabilities becomes:

	 $ RNAfold --commands=commands.txt -p <	sequence.fa

       The resulting MFE plot will be annotated	to display the binding site(s)
       of the ligand, and the base pair	probability dot-plot  is  extended  to
       include	the  probability  that a particular nucleotide is bound	by the
       ligand.

POST-TRANSCRIPTIONAL MODIFICATION EXAMPLES
       Many RNA	molecules harbor (post-transcriptional)	 modifications.	 These
       modified	 base often change the pairing behavior	or energy contribution
       for the loops they are part of.	To accommodate for that	effect	(to  a
       certain degree) one may use additional correcting energy	parameters for
       loops  with  the	respective modified bases. In literature, a few	stack-
       ing- and	some terminal mismatch energies	can be found. Some of them are
       already provided	within the ViennaRNA Package. The  --modification  and
       --mod-file  command  line parameters can	be used	to apply these parame-
       ters in the predictions.	While the former allows	one to select a	subset
       of implemented modified base corrections, the latter enables  the  pre-
       diction	programs  to  read energy parameters for modified bases	from a
       user-provided JSON file.

       Consider,  for  instance,  the  following  tRNA	sequence  with	 dihy-
       drouridines and pseudouridines annotated	by their respective one-letter
       codes D and P:

	 $ cat tRNAphe.fa
	 >tRNAphe
	 GCCGAAAUAGCUCAGDDGGGAGAGCGPPAGACUGAAGAPCUAAAGGDCCCUGGUPCGAUCCCGGGUUUCGGCACCA

       Now, a prediction that includes support for the destabilizing effect of
       D  and the stabilizing effects of P within base pair stacks can be done
       as follows:

	 $ RNAfold --modifications=DP <	tRNAphe.fa
	 >tRNAphe
	 GCCGAAAUAGCUCAGDDGGGAGAGCGPPAGACUGAAGAPCUAAAGGDCCCUGGUPCGAUCCCGGGUUUCGGCACCA
	 (((((((..((((........)))).(((((.......)))))....(((.((......)).)))))))))).... (-23.37)

AUTHOR
       Ivo L Hofacker, Walter Fontana, Sebastian Bonhoeffer, Peter F  Stadler,
       Ronny Lorenz

REPORTING BUGS
       If  in doubt our	program	is right, nature is at fault.  Comments	should
       be sent to rna@tbi.univie.ac.at.

RNAfold	2.7.0			 October 2024			    RNAFOLD(1)

Want to link to this manual page? Use this URL:
<https://man.freebsd.org/cgi/man.cgi?query=RNAfold&sektion=1&manpath=FreeBSD+Ports+15.0.quarterly>

home | help