Skip site navigation (1)Skip section navigation (2)

FreeBSD Manual Pages

  
 
  

home | help
RNAUP(1)			 User Commands			      RNAUP(1)

NAME
       RNAup - manual page for RNAup 2.7.0

SYNOPSIS
       RNAup [OPTION]...

DESCRIPTION
       RNAup 2.7.0

       Calculate the thermodynamics of RNA-RNA interactions

       RNAup  calculates the thermodynamics of RNA-RNA interactions, by	decom-
       posing the binding into two stages. (1) First the  probability  that  a
       potential binding sites remains unpaired	(equivalent to the free	energy
       needed  to  open	 the site) is computed.	(2) Then this accessibility is
       combined	with the interaction energy to obtain the  total  binding  en-
       ergy.  All  calculations	are done by computing partition	functions over
       all possible conformations.

       RNAup provides two different modes: By default RNAup computes  accessi-
       bilities,  in  terms  of	the free energies needed to open a region (de-
       fault length 4).	It prints the region of	highest	accessibility and  its
       opening	energy	to  stdout, opening energies for all other regions are
       written to a file.

       In interaction mode the interaction between two RNAs is calculated.  It
       is  invoked if the input	consists of two	sequences concatenated with an
       '&', or if the options -X[pf] or	-b are given. Unless the -b option  is
       specified  RNAup	assumes	that the longer	RNA is a structured target se-
       quence while the	shorter	one is an unstructured small RNA.
       Additionally, for every position	along the target sequence we write the
       best free energy	of binding for an interaction that includes this posi-
       tion to the the output file.  Output to stdout consists of the location
       and free	energy,	dG, for	the optimal region of interaction. The binding
       energy dG is also split into  its  components  the  interaction	energy
       dGint  and the opening energy dGu_l (and	possibly dGu_s for the shorter
       sequence).
       In addition we print the	optimal	interaction structure as  computed  by
       RNAduplex  for  this region. Note that it can happen that the RNAduplex
       computed	optimal	interaction does not coincide with the	optimal	 RNAup
       region.	If the two predictions don't match the structure string	is re-
       placed by a run of "."  and a message is	written	to stderr.

       Each sequence should be in 5' to	3' direction. If the sequence is  pre-
       ceded by	a line of the form
       > name

       the  output file	"name_ux_up.out" is produced, where the	"x" in "ux" is
       the value set by	the -u option. Otherwise the  file  name  defaults  to
       RNA_ux_up.out.  The output is concatenated if a file with the same name
       exists.

       RNA sequences are read from stdin as strings of characters. White space
       and newline within a sequence cause an error! Newline is	used to	 sepa-
       rate sequences. The program will	continue to read new sequences until a
       line  consisting	 of the	single character @ or an end of	file condition
       is encountered.

       -h, --help
	      Print help and exit

       --detailed-help
	      Print help, including all	details	and hidden options, and	exit

       --full-help
	      Print help, including hidden options, and	exit

       -V, --version
	      Print version and	exit

       -v, --verbose
	      Be verbose.  (default=off)

	      Lower the	log level setting such that  even  INFO	 messages  are
	      passed through.

   I/O Options:
	      Command line options for input and output	(pre-)processing

       -o, --no_output_file
	      Do not produce an	output file.

	      (default=off)

       --no_header
	      Do not produce a header with the command line parameters used in
	      the outputfile.

	      (default=off)

       --noconv
	      Do not automatically substitute nucleotide "T" with "U".

	      (default=off)

       --log-level=level
	      Set log level threshold.	(default=`2')

	      By  default,  any	log messages are filtered such that only warn-
	      ings (level 2) or	errors (level 3) are printed. This setting al-
	      lows for specifying the log level	threshold, where higher	values
	      result in	fewer information. Log-level 5 turns off all messages,
	      even errors and other critical information.

       --log-file[=filename]
	      Print  log  messages  to	a  file	 instead  of   stderr.	  (de-
	      fault=`RNAup.log')

       --log-time
	      Include time stamp in log	messages.

	      (default=off)

       --log-call
	      Include file and line of log calling function.

	      (default=off)

   Algorithms:
	      Select  additional  algorithms  which  should be included	in the
	      calculations.

       -u, --ulength=length
	      Specify the length of the	unstructured region in the output.

	      (default=`4')

	      The probability of being unpaired	is plotted on the right	border
	      of the unpaired region. You  can	specify	 up  to	 20  different
	      length  values:  use "-" to specify a range of continuous	values
	      (e.g. -u 4-8) or specify a list of comma separated values	 (e.g.
	      -u 4,8,15).

       -c, --contributions=SHIME
	      Specify the contributions	listed in the output.  (default=`S')

	      By  default only the full	probability of being unpaired is plot-
	      ted. The -c option allows	one to get the different contributions
	      (c) to the probability of	being unpaired:	The  full  probability
	      of  being	 unpaired  ("S"	is the sum of the probability of being
	      unpaired in the exterior	loop  ("E"),  within  a	 hairpin  loop
	      ("H"),  within  an  internal  loop  ("I")	and within a multiloop
	      ("M"). Any combination of	these letters may be given.

   Calculations	of RNA-RNA interactions:
       -w, --window=INT
	      Set the maximal length of	the region of interaction.

	      (default=`25')

       -b, --include_both
	      Include the probability of unpaired regions in both (b) RNAs.

	      (default=off)

	      By default only the probability of being unpaired	in the	longer
	      RNA (target) is used.

       -5, --extend5=INT
	      Extend  the region of interaction	in the target to some residues
	      on the 5'	side.

	      The underlying assumption	is that	it is favorable	for an	inter-
	      action  if not only the direct region of contact is unpaired but
	      also a few residues 5'

       -3, --extend3=INT
	      Extend the region	of interaction in the target to	some  residues
	      on the 3'	side.

	      The  underlying assumption is that it is favorable for an	inter-
	      action if	not only the direct region of contact is unpaired  but
	      also a few residues 3'

       --interaction_pairwise
	      Activate pairwise	interaction mode.  (default=off)

	      The  first  sequence  interacts with the 2nd, the	third with the
	      4th etc. If activated, two interacting sequences may be given in
	      a	single line separated by "&" or	each sequence may be given  on
	      an extra line.

       --interaction_first
	      Activate interaction mode	using first sequence only.

	      (default=off)

	      The  interaction	of  each sequence with the first one is	calcu-
	      lated (e.g.  interaction of one mRNA with	many small RNAs). Each
	      sequence has to be given on an extra line

       -S, --pfScale=DOUBLE
	      In the calculation of the	pf use scale*mfe as  an	 estimate  for
	      the ensemble free	energy (used to	avoid overflows).

	      (default=`1.07')

	      The  default is 1.07, useful values are 1.0 to 1.2. Occasionally
	      needed for long sequences.

   Structure Constraints:
	      Command line options to interact with the	structure  constraints
	      feature of this program

       -C, --constraint
	      Apply structural constraint(s) during prediction.

	      (default=off)

	      The program first	reads the sequence(s), then a dot-bracket like
	      string  containing  constraints  on the structure. The following
	      symbols are recognized:

	      '.' ... no constraint for	this base

	      'x' ... the base is unpaired

	      '<' ... the base pairs downstream, i.e. i	is paired with j > i

	      '>' ... the base pairs upstream, i.e. i is paired	with j < i

	      '()' ... base i pairs with base j

	      '|' ... the corresponding	base has to be paired  intermolecular-
	      ily (only	for

	      interaction mode)

   Energy Parameters:
	      Energy  parameter	 sets  can be adapted or loaded	from user-pro-
	      vided input files

       -T, --temp=DOUBLE
	      Rescale energy parameters	to a temperature of temp C. Default is
	      37C.

	      (default=`37.0')

       -P, --paramFile=paramfile
	      Read energy parameters from paramfile, instead of	using the  de-
	      fault parameter set.

	      Different	 sets  of energy parameters for	RNA and	DNA should ac-
	      company your distribution.  See the RNAlib documentation for de-
	      tails on the file	format.	The placeholder	file name 'DNA'	can be
	      used to load DNA parameters without the need to actually specify
	      any input	file.

       -4, --noTetra
	      Do not include special tabulated stabilizing energies for	 tri-,
	      tetra- and hexaloop hairpins.

	      (default=off)

	      Mostly for testing.

       --salt=DOUBLE
	      Set salt concentration in	molar (M). Default is 1.021M.

       --saltInit=DOUBLE
	      Provide salt correction for duplex initialization	(in kcal/mol).

   Model Details:
	      Tweak  the energy	model and pairing rules	additionally using the
	      following	parameters

       -d, --dangles=INT
	      Specify "dangling	end" model for bases adjacent  to  helices  in
	      free ends	and multi-loops.

	      (default=`2')

	      With  -d2	dangling energies will be added	for the	bases adjacent
	      to a helix on both sides in any case.

	      The option -d0 ignores dangling ends altogether (mostly for  de-
	      bugging).

       --noLP Produce structures without lonely	pairs (helices of length 1).

	      (default=off)

	      For  partition  function	folding	this only disallows pairs that
	      can only occur isolated. Other pairs may still occasionally  oc-
	      cur as helices of	length 1.

       --noGU Do not allow GU pairs.

	      (default=off)

       --noClosingGU
	      Do not allow GU pairs at the end of helices.

	      (default=off)

       --nsp=STRING
	      Allow other pairs	in addition to the usual AU,GC,and GU pairs.

	      Its  argument  is	a comma	separated list of additionally allowed
	      pairs. If	the first character is a "-" then AB will  imply  that
	      AB and BA	are allowed pairs, e.g.	--nsp="-GA"  will allow	GA and
	      AG pairs.	Nonstandard pairs are given 0 stacking energy.

       --energyModel=INT
	      Set energy model.

	      Rarely used option to fold sequences from	the artificial ABCD...
	      alphabet,	 where	A pairs	B, C-D etc.  Use the energy parameters
	      for GC (--energyModel 1) or AU (--energyModel 2) pairs.

       --helical-rise=FLOAT
	      Set the helical rise of the helix	in units of Angstrom.

	      (default=`2.8')

	      Use with caution!	This value will	be re-set automatically	to 3.4
	      in case DNA parameters are loaded	via  -P	 DNA  and  no  further
	      value is provided.

       --backbone-length=FLOAT
	      Set  the	average	backbone length	for looped regions in units of
	      Angstrom.

	      (default=`6.0')

	      Use with caution!	This value will	 be  re-set  automatically  to
	      6.76 in case DNA parameters are loaded via -P DNA	and no further
	      value is provided.

REFERENCES
       If you use this program in your work you	might want to cite:

       R.  Lorenz,  S.H.  Bernhart,  C.	 Hoener	 zu Siederdissen, H. Tafer, C.
       Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA	Package	 2.0",
       Algorithms for Molecular	Biology: 6:26

       I.L.  Hofacker,	W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P.
       Schuster	(1994),	"Fast Folding and Comparison of	RNA  Secondary	Struc-
       tures", Monatshefte f. Chemie: 125, pp 167-188

       R.  Lorenz,  I.L. Hofacker, P.F.	Stadler	(2016),	"RNA folding with hard
       and soft	constraints", Algorithms for Molecular Biology 11:1 pp 1-13

       U. Mueckstein, H. Tafer,	J. Hackermueller, S.H. Bernhart, P.F. Stadler,
       and I.L.	Hofacker (2006), "Thermodynamics of RNA-RNA  Binding",	Bioin-
       formatics: 22(10), pp 1177-1182

       The energy parameters are taken from:

       D.H.  Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J.
       Susan, M. Zuker,	D.H. Turner (2004), "Incorporating chemical  modifica-
       tion constraints	into a dynamic programming algorithm for prediction of
       RNA secondary structure", Proc. Natl. Acad. Sci.	USA: 101, pp 7287-7292

       D.H  Turner, D.H. Mathews (2009), "NNDB:	The nearest neighbor parameter
       database	for predicting stability of nucleic acid secondary structure",
       Nucleic Acids Research: 38, pp 280-282

EXAMPLES
       Output to stdout:

       In Interaction mode RNAup prints	the most favorable interaction	energy
       between the two sequences to stdout. The	most favorable interaction en-
       ergy (dG) depends on the	position in the	longer sequence	(region	[i,j])
       and  the	 position  in the shorter sequence (region[k,l]): dG[i,j;k,l].
       dG[i,j;k,l] is the largest contribution to dG[i,j] = sum_kl dG[i,j;k,l]
       which is	given in the output file: therefore dG[i,j;k,l]	<= dG[i,j].

	 '....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
	 > franz
	 GGAGUAGGUUAUCCUCUGUU
	 > sissi
	 AGGACAACCU
	 dG = dGint + dGu_l
	 (((((.((((&)))).)))))	 6,15  :   1,10	 (-6.66	= -9.89	+ 3.23)
	 AGGUUAUCCU&AGGACAACCU
	 RNAup output in file: franz_sissi_w25_u3_4_up.out

       where the result	line contains following	information

	 RNAduplex results	 [i,j]	   [k,l]    dG = dGint + dGu_l
	 (((((.((((&)))).)))))	 6,15	:  1,10	    (-6.66=-9.89+3.23)

       Output to file:

       Output to file contains a header	including date,	the  command  line  of
       the  call  to RNAup, length and names of	the input sequence(s) followed
       by the sequence(s). The first sequence is the target sequence.	Print-
       ing of the header can be	turned off using the -nh option.

       The  line directly after	the header gives the column names for the out-
       put:

	 position     dGu_l for	-u 3	  dGu_l	for -u 4       dG
       #     pos      u3S	u3H	  u4S	    u4H	       dG

       where all information refers to the target sequence. The	 dGu_l	column
       contains	 information about the -u value	(u=3 or	u=4) and the contribu-
       tion to the free	energy to open all  structures	"S"  or	 only  hairpin
       loops  "H",  see	option -c.  NA means that no results is	possible (e.g.
       column u3S row 2: no region of length 3 ending at position 2 exists).

       #  Thu Apr 10 09:15:11 2008
       #  RNAup	-u 3,4 -c SH -b
       #  20 franz
       #  GGAGUAGGUUAUCCUCUGUU
       #  10 sissi
       #  AGGACAACCU
       #     pos      u3S	u3H	  u4S	    u4H	       dG
	      1	       NA	 NA	   NA	     NA	   -1.540
	      2	       NA	 NA	   NA	     NA	   -1.540
	      3	    1.371	 NA	   NA	     NA	   -1.217
	      4	    1.754     5.777	1.761	     NA	   -1.393
	      5	    1.664     3.140	1.811	  5.800	   -1.393

       If the -b option	is selected position and dGu_s values for the  shorter
       sequence	are written after the information for the target sequence.

AUTHOR
       Ivo L Hofacker, Peter F Stadler,	Ulrike Mueckstein, Ronny Lorenz

REPORTING BUGS
       If  in doubt our	program	is right, nature is at fault.  Comments	should
       be sent to rna@tbi.univie.ac.at.

RNAup 2.7.0			 October 2024			      RNAUP(1)

Want to link to this manual page? Use this URL:
<https://man.freebsd.org/cgi/man.cgi?query=RNAup&sektion=1&manpath=FreeBSD+Ports+15.0.quarterly>

home | help