FreeBSD Manual Pages
bl_next_start_codon(3) Library Functions Manual bl_next_start_codon(3) NAME bl_next_start_codon() - Find next start codon LIBRARY #include <biolibc/translate.h> -lbiolibc SYNOPSIS long bl_next_start_codon(FILE *rna_stream, char codon[4]) ARGUMENTS rna_stream FILE stream containing RNA sequence data codon 4-character buffer to receive codon sequence Set to "" if no codon found DESCRIPTION Locate the next start codon in stream and report its position in the input. Reported positions are 0-based offsets from the file position at the time of the call. Hence, to find the absolute positions of codons within a file stream across multiple calls to next_start_codon() or next_stop_codon(), their return values should added to the previous return value + 3 (the size of the previous codon). For example, givent the following input: acaucauguucguggugacc A call to next_start_codon() will return 5 (off set of AUG from the be- ginning of the sequence and a subsequent call to next_stop_codon() will return 7 (offset of UGA from the first base after the AUG). RETURN VALUES 1-based position of the next start codon within the stream or EOF if no codon is found. EXAMPLES unsigned long pos; char codon[4]; if ( (pos = next_start_codon(stdin)) != EOF ) { printf("Start codon at %lu.n", pos); if ( (pos = next_stop_codon(stdin, codon)) != EOF ) printf("Stop codon %s at %lu.n", codon, pos); else puts("No stop codon found."); } else puts("No start codon found."); SEE ALSO next_stop_codon(3) bl_next_start_codon(3)
NAME | LIBRARY | SYNOPSIS | ARGUMENTS | DESCRIPTION | RETURN VALUES | EXAMPLES | SEE ALSO
Want to link to this manual page? Use this URL:
<https://man.freebsd.org/cgi/man.cgi?query=bl_next_start_codon&sektion=3&manpath=FreeBSD+Ports+15.1.quarterly>
