FreeBSD Manual Pages
bl_next_stop_codon(3) Library Functions Manual bl_next_stop_codon(3) NAME bl_next_stop_codon() - Find next stop codon LIBRARY #include <biolibc/translate.h> -lbiolibc SYNOPSIS long bl_next_stop_codon(FILE *rna_stream, char codon[4]) ARGUMENTS rna_stream FILE stream containing RNA sequence data codon 4-character buffer to receive codon sequence Set to "" if no codon found DESCRIPTION Locate the next stop codon in stream and report its position in the in- put. Reported positions are 0-based offsets from the file position at the time of the call. Hence, to find the absolute positions of codons within a file stream across multiple calls to next_start_codon() or next_stop_codon(), their return values should added to the previous re- turn value + 3 (the size of the previous codon). For example, givent the following input: acaucauguucguggugacc A call to next_start_codon() will return 5 (off set of AUG from the be- ginning of the sequence and a subsequent call to next_stop_codon() will return 7 (offset of UGA from the first base after the AUG). RETURN VALUES 1-based position of the next stop codon within the stream or EOF if no codon is found. EXAMPLES unsigned long pos; char codon[4]; if ( (pos = next_start_codon(stdin)) != EOF ) { printf("Start codon at %lu.n", pos); if ( (pos = next_stop_codon(stdin, codon)) != EOF ) printf("Stop codon %s at %lu.n", codon, pos); else puts("No stop codon found."); } else puts("No start codon found."); SEE ALSO next_stop_codon(3) bl_next_stop_codon(3)
NAME | LIBRARY | SYNOPSIS | ARGUMENTS | DESCRIPTION | RETURN VALUES | EXAMPLES | SEE ALSO
Want to link to this manual page? Use this URL:
<https://man.freebsd.org/cgi/man.cgi?query=bl_next_stop_codon&sektion=3&manpath=FreeBSD+Ports+15.1.quarterly>
